|     home    |     search     |     content     |     mail     |     login     |

table information

    

tablecode1195
nametblIL28B
physical file d_data  (SQL Server 2005)
descriptionSingle nucleotide polymorphism (SNP) genotyping was performed using Allelic Discrimination assays from Applied Biosystems for the SNPs rs8099917 and rs12979860 following the instructions of the manufacturer.
comment short
comment longGenotyping for rs8099917 was performed using predesigned assays (Applied Biosystems, assay ID C__11710096_10).

Genotyping for rs12979860 was performed using Taqman custom-designed primers and probes as follows: forward primer GCCTGTCGTGTACTGAACCA, reverse primer GCGCGGAGTGCAATTCAAC, and probes TGGTTCGCGCCTTC (VIC) and CTGGTTCACGCCTTC (FAM) (Applied Biosystems).

Before performing the PCR reactions DNA is added with Allelic Discrimination Assay Mix and TaqMan Universal PCR Master Mix to MicroAmp Optical 96-Well Reaction Plates (Applied Biosystems). Real-Time PCR reactions were performed using the ABI Prism 7900HT system (Applied Biosystems). After preheating for 10 min. at 95C, 40 cycles of 15 seconds at 95C and one minute at 60C followed. Data were analyzed using the ABI PRISM SDS software v.2.2.1 (Applied Biosystems).
number of records106
startdate
stopdate
resp. centreGGD
record6-nov-2014 11:49


This screen displays information about a table.
  • click on "fields" to view information about the fields of this table
  • click on "studies" to view a list of studies that used this table
  • click on "SPSS labels" to generate an SPSS syntax file with field and variable labels
  • click on "code books" to view a list of codebooks that reference this table
  • click on "ID's" to view more information about the ID's in this table (only available with sufficient rights)
  • faq